ID: 1112787483

View in Genome Browser
Species Human (GRCh38)
Location 13:102967067-102967089
Sequence AGAAACTTACAGTTGATTAA GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1112787481_1112787483 5 Left 1112787481 13:102967039-102967061 CCAACACTACAAAGTGCAGATAC No data
Right 1112787483 13:102967067-102967089 AGAAACTTACAGTTGATTAAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1112787483 Original CRISPR AGAAACTTACAGTTGATTAA GGG Intergenic
No off target data available for this crispr