ID: 1112789863

View in Genome Browser
Species Human (GRCh38)
Location 13:102991453-102991475
Sequence TTAGCCCACCAAATCCTCTG TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1112789863_1112789864 18 Left 1112789863 13:102991453-102991475 CCACAGAGGATTTGGTGGGCTAA No data
Right 1112789864 13:102991494-102991516 TTGTGCTTTTAAAAGTTTCCTGG No data
1112789863_1112789868 25 Left 1112789863 13:102991453-102991475 CCACAGAGGATTTGGTGGGCTAA No data
Right 1112789868 13:102991501-102991523 TTTAAAAGTTTCCTGGGGCTGGG No data
1112789863_1112789865 19 Left 1112789863 13:102991453-102991475 CCACAGAGGATTTGGTGGGCTAA No data
Right 1112789865 13:102991495-102991517 TGTGCTTTTAAAAGTTTCCTGGG No data
1112789863_1112789867 24 Left 1112789863 13:102991453-102991475 CCACAGAGGATTTGGTGGGCTAA No data
Right 1112789867 13:102991500-102991522 TTTTAAAAGTTTCCTGGGGCTGG No data
1112789863_1112789866 20 Left 1112789863 13:102991453-102991475 CCACAGAGGATTTGGTGGGCTAA No data
Right 1112789866 13:102991496-102991518 GTGCTTTTAAAAGTTTCCTGGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1112789863 Original CRISPR TTAGCCCACCAAATCCTCTG TGG (reversed) Intergenic
No off target data available for this crispr