ID: 1112789864

View in Genome Browser
Species Human (GRCh38)
Location 13:102991494-102991516
Sequence TTGTGCTTTTAAAAGTTTCC TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1112789863_1112789864 18 Left 1112789863 13:102991453-102991475 CCACAGAGGATTTGGTGGGCTAA No data
Right 1112789864 13:102991494-102991516 TTGTGCTTTTAAAAGTTTCCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1112789864 Original CRISPR TTGTGCTTTTAAAAGTTTCC TGG Intergenic
No off target data available for this crispr