ID: 1112795142

View in Genome Browser
Species Human (GRCh38)
Location 13:103048654-103048676
Sequence TCAACTAGGTGAAGGCCAGT GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 121
Summary {0: 1, 1: 0, 2: 1, 3: 8, 4: 111}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1112795137_1112795142 7 Left 1112795137 13:103048624-103048646 CCCTTGGAAAGGAAAATGTAGAA 0: 1
1: 0
2: 2
3: 58
4: 499
Right 1112795142 13:103048654-103048676 TCAACTAGGTGAAGGCCAGTGGG 0: 1
1: 0
2: 1
3: 8
4: 111
1112795138_1112795142 6 Left 1112795138 13:103048625-103048647 CCTTGGAAAGGAAAATGTAGAAA 0: 1
1: 0
2: 6
3: 62
4: 600
Right 1112795142 13:103048654-103048676 TCAACTAGGTGAAGGCCAGTGGG 0: 1
1: 0
2: 1
3: 8
4: 111

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1112795142 Original CRISPR TCAACTAGGTGAAGGCCAGT GGG Intronic