ID: 1112802646

View in Genome Browser
Species Human (GRCh38)
Location 13:103129633-103129655
Sequence TCAGTGGCCCCCTGGGCTCT TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1112802636_1112802646 28 Left 1112802636 13:103129582-103129604 CCTTCAATGTAGGAACCCCAGGC No data
Right 1112802646 13:103129633-103129655 TCAGTGGCCCCCTGGGCTCTTGG No data
1112802639_1112802646 11 Left 1112802639 13:103129599-103129621 CCAGGCTCTCTGCCTTCAGACTT No data
Right 1112802646 13:103129633-103129655 TCAGTGGCCCCCTGGGCTCTTGG No data
1112802638_1112802646 12 Left 1112802638 13:103129598-103129620 CCCAGGCTCTCTGCCTTCAGACT No data
Right 1112802646 13:103129633-103129655 TCAGTGGCCCCCTGGGCTCTTGG No data
1112802637_1112802646 13 Left 1112802637 13:103129597-103129619 CCCCAGGCTCTCTGCCTTCAGAC No data
Right 1112802646 13:103129633-103129655 TCAGTGGCCCCCTGGGCTCTTGG No data
1112802642_1112802646 -1 Left 1112802642 13:103129611-103129633 CCTTCAGACTTCGGGATCTGCAT No data
Right 1112802646 13:103129633-103129655 TCAGTGGCCCCCTGGGCTCTTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1112802646 Original CRISPR TCAGTGGCCCCCTGGGCTCT TGG Intergenic
No off target data available for this crispr