ID: 1112806758

View in Genome Browser
Species Human (GRCh38)
Location 13:103171470-103171492
Sequence CACCTTTATCAGATTCACCT AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1112806758_1112806762 8 Left 1112806758 13:103171470-103171492 CCTAGGTGAATCTGATAAAGGTG No data
Right 1112806762 13:103171501-103171523 GAGCTCTGTGTGTTGCCTCTCGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1112806758 Original CRISPR CACCTTTATCAGATTCACCT AGG (reversed) Intergenic
No off target data available for this crispr