ID: 1112806762

View in Genome Browser
Species Human (GRCh38)
Location 13:103171501-103171523
Sequence GAGCTCTGTGTGTTGCCTCT CGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1112806755_1112806762 27 Left 1112806755 13:103171451-103171473 CCTTTCAGCACTGTTCTGTCCTA No data
Right 1112806762 13:103171501-103171523 GAGCTCTGTGTGTTGCCTCTCGG No data
1112806758_1112806762 8 Left 1112806758 13:103171470-103171492 CCTAGGTGAATCTGATAAAGGTG No data
Right 1112806762 13:103171501-103171523 GAGCTCTGTGTGTTGCCTCTCGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1112806762 Original CRISPR GAGCTCTGTGTGTTGCCTCT CGG Intergenic
No off target data available for this crispr