ID: 1112809102

View in Genome Browser
Species Human (GRCh38)
Location 13:103197024-103197046
Sequence CCTGCTTTGCAGGTGGGAGA TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1112809096_1112809102 6 Left 1112809096 13:103196995-103197017 CCAGGTTGAGACATCCTCAGGGT No data
Right 1112809102 13:103197024-103197046 CCTGCTTTGCAGGTGGGAGATGG No data
1112809097_1112809102 -8 Left 1112809097 13:103197009-103197031 CCTCAGGGTCTACAGCCTGCTTT No data
Right 1112809102 13:103197024-103197046 CCTGCTTTGCAGGTGGGAGATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1112809102 Original CRISPR CCTGCTTTGCAGGTGGGAGA TGG Intergenic
No off target data available for this crispr