ID: 1112810910

View in Genome Browser
Species Human (GRCh38)
Location 13:103217448-103217470
Sequence TTCAACCATCAGGATGGGGT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1112810910_1112810916 8 Left 1112810910 13:103217448-103217470 CCCACCCCATCCTGATGGTTGAA No data
Right 1112810916 13:103217479-103217501 GTTCATACAGCTAAAGAATGAGG No data
1112810910_1112810917 12 Left 1112810910 13:103217448-103217470 CCCACCCCATCCTGATGGTTGAA No data
Right 1112810917 13:103217483-103217505 ATACAGCTAAAGAATGAGGCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1112810910 Original CRISPR TTCAACCATCAGGATGGGGT GGG (reversed) Intergenic
No off target data available for this crispr