ID: 1112814114

View in Genome Browser
Species Human (GRCh38)
Location 13:103252013-103252035
Sequence CTCTGTCCTTGCCATAAGGC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1112814114_1112814118 6 Left 1112814114 13:103252013-103252035 CCTGCCTTATGGCAAGGACAGAG No data
Right 1112814118 13:103252042-103252064 CTGTATCACTGTTCTTGCCTTGG No data
1112814114_1112814120 23 Left 1112814114 13:103252013-103252035 CCTGCCTTATGGCAAGGACAGAG No data
Right 1112814120 13:103252059-103252081 CCTTGGTGTACCAGAAGAATTGG 0: 44
1: 90
2: 128
3: 118
4: 178

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1112814114 Original CRISPR CTCTGTCCTTGCCATAAGGC AGG (reversed) Intergenic
No off target data available for this crispr