ID: 1112814118

View in Genome Browser
Species Human (GRCh38)
Location 13:103252042-103252064
Sequence CTGTATCACTGTTCTTGCCT TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1112814117_1112814118 2 Left 1112814117 13:103252017-103252039 CCTTATGGCAAGGACAGAGGGCT No data
Right 1112814118 13:103252042-103252064 CTGTATCACTGTTCTTGCCTTGG No data
1112814113_1112814118 7 Left 1112814113 13:103252012-103252034 CCCTGCCTTATGGCAAGGACAGA No data
Right 1112814118 13:103252042-103252064 CTGTATCACTGTTCTTGCCTTGG No data
1112814114_1112814118 6 Left 1112814114 13:103252013-103252035 CCTGCCTTATGGCAAGGACAGAG No data
Right 1112814118 13:103252042-103252064 CTGTATCACTGTTCTTGCCTTGG No data
1112814112_1112814118 8 Left 1112814112 13:103252011-103252033 CCCCTGCCTTATGGCAAGGACAG No data
Right 1112814118 13:103252042-103252064 CTGTATCACTGTTCTTGCCTTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1112814118 Original CRISPR CTGTATCACTGTTCTTGCCT TGG Intergenic
No off target data available for this crispr