ID: 1112814120

View in Genome Browser
Species Human (GRCh38)
Location 13:103252059-103252081
Sequence CCTTGGTGTACCAGAAGAAT TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 558
Summary {0: 44, 1: 90, 2: 128, 3: 118, 4: 178}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1112814117_1112814120 19 Left 1112814117 13:103252017-103252039 CCTTATGGCAAGGACAGAGGGCT No data
Right 1112814120 13:103252059-103252081 CCTTGGTGTACCAGAAGAATTGG 0: 44
1: 90
2: 128
3: 118
4: 178
1112814113_1112814120 24 Left 1112814113 13:103252012-103252034 CCCTGCCTTATGGCAAGGACAGA No data
Right 1112814120 13:103252059-103252081 CCTTGGTGTACCAGAAGAATTGG 0: 44
1: 90
2: 128
3: 118
4: 178
1112814112_1112814120 25 Left 1112814112 13:103252011-103252033 CCCCTGCCTTATGGCAAGGACAG No data
Right 1112814120 13:103252059-103252081 CCTTGGTGTACCAGAAGAATTGG 0: 44
1: 90
2: 128
3: 118
4: 178
1112814114_1112814120 23 Left 1112814114 13:103252013-103252035 CCTGCCTTATGGCAAGGACAGAG No data
Right 1112814120 13:103252059-103252081 CCTTGGTGTACCAGAAGAATTGG 0: 44
1: 90
2: 128
3: 118
4: 178

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1112814120 Original CRISPR CCTTGGTGTACCAGAAGAAT TGG Intergenic
900745414 1:4357351-4357373 CCTTGGTGTACTAGAAGAATTGG - Intergenic
903407351 1:23108977-23108999 CCTGGGTGTACCAATAGAATTGG - Intronic
903506354 1:23838360-23838382 CCTTGGTGTACCAGAAGAATTGG - Intronic
905994984 1:42374009-42374031 AGTTGGTGTACGAAAAGAATTGG - Intergenic
906289671 1:44611418-44611440 ACTTGGTGTACCAGGCTAATGGG + Intronic
907962201 1:59294265-59294287 CCTTGGTGTAGCAGAAGAATTGG - Intergenic
908513293 1:64867459-64867481 CCTTGGTGACCCAGAAAATTGGG - Intronic
908892101 1:68859950-68859972 CCCTAATGTACCAGAAAAATCGG + Intergenic
908929900 1:69306004-69306026 CCTTGGTGTACCAGAAAAATTGG + Intergenic
909586026 1:77289431-77289453 CCTTGATGTAACAAAAGTATGGG - Intronic
910050958 1:82973531-82973553 CCTTGGTGTACCGGAAGAATCGG - Intergenic
911058551 1:93728495-93728517 CCTTGGTGTACCAGAAGAATTGG + Intronic
911587232 1:99704963-99704985 CCTTGGTGTACCAGGAGAATCGG - Intergenic
911646733 1:100344982-100345004 CCTTAGTGTTCCAGAAGCCTGGG - Intergenic
917254848 1:173103507-173103529 CCTTGGTGTACTGGAAGAATTGG + Intergenic
917554270 1:176067685-176067707 TCTTGGTGTACCAGAAAAATTGG - Intronic
918024777 1:180732820-180732842 CCTTGGTGTACAGGAAGAATCGG + Intronic
918526152 1:185467168-185467190 GCCCAGTGTACCAGAAGAATTGG + Intergenic
918719578 1:187836372-187836394 CCCTGGTGTACCAGAAGAATCGG + Intergenic
918794439 1:188874491-188874513 GCCTAGTGTCCCAGAAGAATTGG + Intergenic
918809297 1:189094530-189094552 CCTTGTTGTACCGGAAGAATCGG - Intergenic
919110878 1:193217365-193217387 TCTTGGTGTACTGGAAGAATCGG + Intronic
919183720 1:194118006-194118028 CCTTAGTGTACTGGAAAAATCGG + Intergenic
919199903 1:194342847-194342869 CATTGGTGTACCAGAAAAGTCGG - Intergenic
920756433 1:208738293-208738315 CCTTGGTGTACCAGAAAAAATGG + Intergenic
921092187 1:211854897-211854919 CCTTGGTGTACTGGATGAATTGG + Intergenic
921116143 1:212093413-212093435 CCTTGGTGTACCAGAAGACTCGG + Intronic
921696253 1:218214406-218214428 CCTTGGTGTACCAGAAGAATCGG - Intergenic
921785919 1:219229512-219229534 CCCTGGTTTACCGGAAGAATCGG - Intergenic
921956074 1:220984181-220984203 CCTTGGTGTACTGGAAAAATTGG - Intergenic
923991685 1:239444792-239444814 TCTTAGTGGCCCAGAAGAATGGG + Intronic
1063238998 10:4149192-4149214 TCTTGGTGTACCAGAAGGATCGG + Intergenic
1063334652 10:5199800-5199822 CTTTGGTTTACCGGAAGGATCGG - Intronic
1064125797 10:12658879-12658901 CCTTGGTGTACCGGAAAAATCGG - Intronic
1064795807 10:19009950-19009972 CCTTAGTGTACTGGAAAAATCGG + Intergenic
1064851515 10:19714168-19714190 CCTTGGTGTACTGGAAAAATTGG + Intronic
1065371525 10:24991715-24991737 CCTTGGTATACTTGAAGAATTGG - Intronic
1065778310 10:29143066-29143088 CCTTGGTGTACCAGAAGAATCGG - Intergenic
1066212347 10:33252293-33252315 CCTTGGTGTACGGGAAGATTCGG - Intronic
1066265775 10:33774463-33774485 CCTTGGTATACCAGAAGAATCGG - Intergenic
1068134690 10:52940213-52940235 CCTTGGTGTACCGGAAGAATAGG - Intergenic
1068258342 10:54543228-54543250 CCTTGGTGTACTGGAAGAATCGG - Intronic
1068370701 10:56109866-56109888 CCTTGGTGTACTGGAAGAATGGG - Intergenic
1068429491 10:56913175-56913197 CCTCGGTGTACTGGAAGAATCGG + Intergenic
1068607936 10:59026359-59026381 CCTTGATGTACCGGAAGAATTGG - Intergenic
1068966376 10:62916008-62916030 CCTTGGTAGACTAGAAGACTAGG - Intronic
1069222656 10:65903657-65903679 CCTTAGTGTACCAGAAAAATTGG - Intergenic
1069352935 10:67551463-67551485 CCTTGGTGTACCAGAAGAATTGG - Intronic
1071028144 10:81140064-81140086 TCTTGGTGTACGGGAAGAATTGG - Intergenic
1071195445 10:83153702-83153724 CCCTAGCGTACCAGAAAAATTGG - Intergenic
1071220433 10:83459103-83459125 CCTTGGTGTACCGGAAGAATCGG - Intergenic
1071486864 10:86107957-86107979 CCTTCATGTACTGGAAGAATTGG - Intronic
1072162475 10:92781407-92781429 CCTTGGTGTACTGGAAGAATTGG - Intergenic
1073393840 10:103201757-103201779 CCTGTATATACCAGAAGAATTGG - Intergenic
1073762851 10:106649124-106649146 CCTTGGTGCACTGGAAGAATCGG - Intronic
1074096535 10:110318252-110318274 CCTTAGTGTATCGGAAAAATTGG - Intergenic
1074177929 10:111029887-111029909 CCTTAGTGTACCAGAAAAATCGG + Intergenic
1074732716 10:116395069-116395091 CCTCGGTGTACCGGAAGAATCGG + Intergenic
1080313331 11:30920233-30920255 CCTTGGGATTCCAGATGAATAGG + Intronic
1081799216 11:45846473-45846495 ACCTGGCGTCCCAGAAGAATGGG + Intergenic
1083388789 11:62333121-62333143 CCTTGGTGTACCAGAAGTATCGG + Intergenic
1084205982 11:67593253-67593275 CCTTGGTGTACTGGAAGAATAGG + Intergenic
1084396545 11:68914640-68914662 CCTTGGGGTACCGGAAGAATCGG + Intronic
1084927027 11:72522193-72522215 CCTTGGTGTACCTGAAGAATCGG + Intergenic
1084987987 11:72894292-72894314 CCTTGGCCTACCAGAACACTGGG - Intronic
1085684090 11:78605915-78605937 CCTTGGTGTACCGGAAGAATCGG - Intergenic
1086395688 11:86412998-86413020 CCTTGGTGTACCAGAAGAATTGG + Intronic
1086573037 11:88306727-88306749 GCTCAGTGTACCAGAAGAATTGG - Intronic
1086605892 11:88696034-88696056 CCCTAGTGTACCAGAAAAATTGG + Intronic
1087139995 11:94755921-94755943 CCCTATTGTACCAGAAAAATTGG + Intronic
1087335515 11:96839519-96839541 CCTTGTTGTACCAGAAGAATCGG + Intergenic
1087461398 11:98453332-98453354 CCTTGGTGTACCAAAAGAATTGG + Intergenic
1087674476 11:101143922-101143944 CCTTAGTGTACATGAAGAAATGG + Intergenic
1087781891 11:102310135-102310157 CTTTGGTGTTCCAGAAGAATAGG - Intergenic
1088103245 11:106177309-106177331 CCTTGGTGTACCAGGAGAATTGG - Intergenic
1088238518 11:107750324-107750346 CCTTGGTGTACTGGAAGAATCGG + Intergenic
1088484162 11:110325144-110325166 CCTTAGTGTACCGGAAAAATCGG + Intergenic
1089021678 11:115222054-115222076 CCTTGGTGTTTCAGAATATTGGG - Intronic
1089122633 11:116148079-116148101 CCTTGGTGTACTGGAAGAATCGG - Intergenic
1089329073 11:117677408-117677430 CCTGTGTGTGTCAGAAGAATGGG + Intronic
1093156194 12:15688757-15688779 CCTTGGCGTATGGGAAGAATCGG - Intronic
1093348939 12:18072542-18072564 CCTTGGTGTGCCTGAAGAATTGG + Intergenic
1093503287 12:19836444-19836466 CCTTGGTGAACCGGAAGAATCGG - Intergenic
1093509044 12:19904220-19904242 TCTTGGGGTACCTAAAGAATTGG - Intergenic
1093654368 12:21677635-21677657 CCTTGGTGTACCCGAAGAATTGG - Intronic
1093655963 12:21694610-21694632 CCTTGGTGTGCCTGAAGAATCGG + Intronic
1094249275 12:28340879-28340901 CCTTTGTGTACTGGAAGAATTGG + Intronic
1094461082 12:30696941-30696963 CCTTGGTGTACCAGAAGAATTGG - Intergenic
1094586578 12:31782510-31782532 CCTTGGTGTAGTGGAAGACTCGG - Intergenic
1095184630 12:39187150-39187172 CCTTGGTGTACTGGAAGAATCGG - Intergenic
1095376136 12:41531147-41531169 CCTTGGTGTACCTGAAGAATCGG + Intronic
1095641883 12:44495099-44495121 CCTCGGTGTGCCTGAAAAATAGG + Intergenic
1095785257 12:46102304-46102326 CCTTGGTCTACCAGAAGAATCGG - Intergenic
1095898607 12:47305411-47305433 CCTTGGTGCACCAGAAGAATTGG + Intergenic
1095919893 12:47518460-47518482 CCTTGGTGTCCCAGAATGCTGGG + Intergenic
1098377762 12:69836010-69836032 CCTTGGTGTACCGGAAGAATCGG + Intronic
1098396834 12:70028490-70028512 CCTTGGTGTACTGGAAAAATCGG + Intergenic
1098433321 12:70444010-70444032 CCTTCTTTTACCAGAAGAAGGGG + Intergenic
1099460013 12:82910568-82910590 CCTTGGTGTATCAGAAGAATCGG + Intronic
1099653302 12:85456828-85456850 CCCTAGTGTACCAGAAGCATCGG - Intergenic
1100641305 12:96484501-96484523 CCTTGGTGTACGGGAAGAACCGG - Intergenic
1100852339 12:98726320-98726342 CCTAGTTGTGTCAGAAGAATTGG + Intronic
1101345534 12:103882874-103882896 CCTGGGTGGATCAGGAGAATTGG - Intergenic
1103674399 12:122644295-122644317 CCTTGGTGTACTGGAAGAATCGG + Intergenic
1104247917 12:127060949-127060971 CCTTGGTGTACCGGAAGAATCGG - Intergenic
1105429780 13:20326235-20326257 CTTTGGTGTACCGGAAGAATCGG - Intergenic
1105594958 13:21828416-21828438 CCTTGGTATACCAGAAGAATTGG - Intergenic
1105614609 13:22000578-22000600 CCTTGGTGTACAGGATGAATCGG - Intergenic
1106112015 13:26785719-26785741 CCTTGGAGTACCAGAAGAATCGG + Intergenic
1106169869 13:27279839-27279861 CCTTGGTGTACTGGAAGAATCGG - Intergenic
1106235353 13:27856539-27856561 CCCTGGTGTACGGGAAGAATCGG + Intergenic
1106541002 13:30690177-30690199 CCTTGGTGTACAGGAAGAATCGG - Intergenic
1109138504 13:58683259-58683281 ACTTGGTGTACCAGAAGAATTGG + Intergenic
1109711374 13:66165078-66165100 TCTTGGTGTACCGGAAGAATAGG + Intergenic
1109784558 13:67156638-67156660 CCTTTGTGTACCGAAAGAATAGG - Intronic
1109943648 13:69404609-69404631 CCTTGGTGTACCGGAAAAATCGG - Intergenic
1110818002 13:79882609-79882631 CCTTGGTGTACCAGAAGAATTGG + Intergenic
1111097281 13:83533192-83533214 CCTTGGTGTAGCAGAAGAATCGG - Intergenic
1111184875 13:84720513-84720535 CCCTAGTGTACCAGAAATATTGG - Intergenic
1111198036 13:84898752-84898774 CCTTGATGTACCAGAAGAATAGG + Intergenic
1111217239 13:85159861-85159883 TCTTGGTGTACCGGAAGAATTGG - Intergenic
1111292193 13:86185098-86185120 CCTTGGTGTACTGGGAGAATCGG - Intergenic
1111292769 13:86188885-86188907 TCTTGGTGTACCAGAAGAATTGG - Intergenic
1111343920 13:86924439-86924461 CCTTGGGGTACTGAAAGAATCGG + Intergenic
1111406224 13:87810805-87810827 CCTTGTTGTACCTGAAGAATCGG + Intergenic
1111413828 13:87912555-87912577 CCCTAATGTACCAGAAAAATCGG - Intergenic
1112064631 13:95780215-95780237 CTTTGGTGTAGCAAAGGAATGGG - Intronic
1112814120 13:103252059-103252081 CCTTGGTGTACCAGAAGAATTGG + Intergenic
1112929260 13:104714115-104714137 CCCTAGTGTATCAGAAAAATCGG - Intergenic
1114924883 14:27384050-27384072 CCTTGGTGTACTGGAAGAATTGG + Intergenic
1115574026 14:34693655-34693677 CCTTGGTGTACCGGAAGAATCGG - Intergenic
1115979118 14:39030177-39030199 CCTTGGTGTACGGGAAGAATCGG + Intergenic
1116298333 14:43141598-43141620 CCTTGGTGTACTGGAAGAATTGG + Intergenic
1117707248 14:58483074-58483096 CATTGGTGTACGTGGAGAATTGG + Intronic
1118487205 14:66225181-66225203 CCCTAGTGTACCGGAAAAATTGG - Intergenic
1120744711 14:88142965-88142987 CCTTTGTGTACCGGAAGAATTGG - Intergenic
1121475637 14:94199548-94199570 CCTTGGTGTACTGGAAGAATCGG + Intronic
1126228310 15:46296560-46296582 CCTTGGTGTACTGGAAGAATCGG - Intergenic
1126278885 15:46919050-46919072 CCTTGGTGTACCGGAAGAATTGG - Intergenic
1126475639 15:49062867-49062889 CTTTGGTGTACCGGAAGAATTGG + Intergenic
1126745005 15:51817491-51817513 CCTTGGTGTGCCGGAAGAATTGG + Intergenic
1126982015 15:54255252-54255274 CTTTGGTGTACTGGAAGAATTGG + Intronic
1127889435 15:63235855-63235877 CCTTGGTATACAAGTAGAGTAGG - Intronic
1128046052 15:64618523-64618545 TCTTGGTGTACTGGAAGAATTGG + Intronic
1128525565 15:68410103-68410125 ACCTGGTATACCAGAAGGATGGG + Intronic
1130682695 15:86010407-86010429 CCTTGGTGTACCGTAAGAATCGG + Intergenic
1131455500 15:92579811-92579833 CCTTGGTCTACCAGGAGAGTGGG + Intergenic
1131557726 15:93414159-93414181 CCTCAGTGTATCAGAAAAATTGG + Intergenic
1132988762 16:2782296-2782318 CCTTGGTCTACCAAAACACTGGG + Intergenic
1134346640 16:13397845-13397867 CCTTGGTGTACCGGAAGAATGGG + Intergenic
1134535988 16:15027502-15027524 TCTTGGTGTACCGGAAGAATGGG + Intronic
1134599576 16:15522974-15522996 CCTTGGTGCACCAGAAGAATCGG + Intronic
1135068715 16:19333676-19333698 CCTTGGTCTACCAAAACACTGGG - Intergenic
1137352574 16:47726462-47726484 CCTAGGTGGACCAGAAGCAAAGG - Intergenic
1137908685 16:52353306-52353328 CATTGGAGTACCAGAAGGAGAGG - Intergenic
1138220047 16:55242636-55242658 CCTTGCTGTACCAGAAAAATTGG - Intergenic
1139064203 16:63292022-63292044 CCTTGGTGTACTGGAAGAATCGG - Intergenic
1139860069 16:70013285-70013307 TCTTGGTGTACCGGAAGAATGGG - Intergenic
1140748124 16:77999054-77999076 CCTAAGTGTACCAGAAAAATTGG + Intergenic
1140782722 16:78311261-78311283 CCTTGGATTACCAAAAAAATTGG - Intronic
1141026166 16:80550881-80550903 CCTTGGTATACCATAGAAATGGG - Intergenic
1141207216 16:81942015-81942037 ACTTCCTGCACCAGAAGAATTGG - Intronic
1142725538 17:1810994-1811016 CCTTGGTGTGCTGGAAGAATCGG - Intronic
1143290231 17:5822704-5822726 CCTTGGTATACCACAAGCATCGG + Intronic
1143292349 17:5840874-5840896 CCTTGGTGTACCAGAATAATCGG + Intronic
1143465517 17:7133867-7133889 CCTTGGTGTACTGGAAGAATGGG + Intergenic
1144320824 17:14117834-14117856 CCCTAGTATACCAGAAAAATTGG + Intronic
1144430951 17:15191355-15191377 CCTTGGTGTACTGGAAGAACTGG + Intergenic
1145353921 17:22119063-22119085 CCTTGATGTACTGGAAGAATTGG + Intergenic
1146659180 17:34653171-34653193 CCATGGTTCACCAGAAGAAAGGG + Intergenic
1147419561 17:40315681-40315703 CCTTGTTGTACTAGAAGTGTGGG + Intronic
1147533106 17:41298674-41298696 CCTTGTTGTACTGGAGGAATCGG - Intergenic
1147921682 17:43921056-43921078 CCTTGGTGTACCAGAAGAATTGG - Intergenic
1148055962 17:44795863-44795885 CCTTAATGTACTGGAAGAATCGG + Intergenic
1149882619 17:60308150-60308172 CCTTGATGTACCAGAAAAGTCGG - Intronic
1150855161 17:68745375-68745397 CCTTAGTGTACAGGAAAAATTGG - Intergenic
1152335246 17:79696957-79696979 CCTTGGTGGACCGGAAGAATCGG - Intergenic
1153023240 18:651024-651046 CCTTGGTGCAACACAATAATAGG + Intronic
1153046332 18:858587-858609 AATTGGTGTACCTGAAGCATGGG + Intergenic
1153310186 18:3669764-3669786 CCTTGGTGCACCGGAAGAACTGG - Intronic
1153351352 18:4083953-4083975 CCTTAGTGTACTGGAAAAATCGG + Intronic
1153475699 18:5496324-5496346 TCTTGGTGTTTCAGAAGCATAGG - Intronic
1153960245 18:10134201-10134223 CCTTGGTGTACCGGAAGAATGGG + Intergenic
1155703506 18:28779070-28779092 CCTTGGTGTACGGAAAGAATTGG - Intergenic
1156691072 18:39707875-39707897 CCTTGGTGTACCAGAAGAATTGG + Intergenic
1157002355 18:43542227-43542249 CCCTGGTGTACTGGAAAAATCGG + Intergenic
1157148577 18:45191404-45191426 TCCTGGGGTTCCAGAAGAATAGG + Intergenic
1157353011 18:46907849-46907871 CCTTGGTGTACCTGGGGGATTGG - Intronic
1158180747 18:54712816-54712838 CCTTGGTGTACCAGAAGAATCGG + Intergenic
1158803289 18:60939262-60939284 ACTTGGTCTACCAGAAGTACTGG + Intergenic
1159416258 18:68152757-68152779 CCTTAGTGTACTGGAAAAATCGG - Intergenic
1159721659 18:71898931-71898953 CCCTGGTGTACCAGAAAAATTGG + Intergenic
1160078274 18:75698983-75699005 CCTTGGTCTATAACAAGAATGGG + Intergenic
1163837295 19:19582631-19582653 CCTTAGTGTACTGGAAAAATCGG - Intronic
1164433725 19:28210015-28210037 ACTTGGTGTTCCAGAAATATTGG - Intergenic
1167332901 19:48867466-48867488 CCTTGGGGAAACAGAAGGATGGG + Intronic
1168178936 19:54646415-54646437 CCTTGGTGTACCGGAAGAACCGG + Intronic
925424770 2:3739722-3739744 CCTTGGTGTACCAGAACAACTGG - Intronic
925839825 2:7980591-7980613 CCTTCCTGTACCAGAAGAATCGG - Intergenic
926825340 2:16900766-16900788 CCTTGGTGTACTGGAAGAATTGG + Intergenic
926825515 2:16901885-16901907 CCTTGGTGTACTGGAAGAATTGG - Intergenic
926961675 2:18364543-18364565 CCTTAGTGTACTGGAAAAATCGG + Intergenic
927368227 2:22324656-22324678 CCTGGGGGTACCAGAAAATTAGG - Intergenic
927584025 2:24282457-24282479 CCTTGGTGTACTGGAAGAATTGG - Intronic
928537910 2:32258018-32258040 CCTTGGTGTACCGGAGGAATTGG + Intronic
928780132 2:34808106-34808128 CCTTAATGTACCAGAAGAAAAGG - Intergenic
928819352 2:35342271-35342293 CCTTGGTGTACTGGAAGAATTGG - Intergenic
929593742 2:43162833-43162855 CCTTGGAGTCCCTGAAGACTTGG - Intergenic
930398075 2:50847969-50847991 CCTTGGTGTGCCAGAAGAATCGG - Intronic
930763655 2:55062238-55062260 CCTTGGTGTACCGGAAGAATTGG - Intronic
931034737 2:58227355-58227377 CCTTGGTGTACTGGAAAAATTGG + Intronic
931288439 2:60851735-60851757 CCTTGGCATACCAGAAACATGGG + Intergenic
931470155 2:62531567-62531589 GGTTGGTGTACCAGAAGAATTGG + Intergenic
932427126 2:71645200-71645222 CCTTGGTGTACTGAAAGAATTGG + Intronic
932576549 2:72965401-72965423 CCTTGGTGTACTGGAAGAATCGG - Intronic
933140880 2:78792129-78792151 CCCTAGTGTACCAGAAAAATTGG + Intergenic
933187141 2:79290825-79290847 CCTTGGTGTACCAGAAGATTTGG - Intronic
933398843 2:81765738-81765760 CTTGGGTGTACCAGAAAAATTGG - Intergenic
934786910 2:97016815-97016837 CCTGAGTGTACCAGAAAACTCGG + Intronic
934902541 2:98172159-98172181 CCTTGGTGTACCAGAAGAATCGG + Intronic
934957077 2:98631759-98631781 CCTTGGTGTACCGGATGAATTGG - Intronic
935138838 2:100333234-100333256 CCCTAGTGTACCAGAAAAATCGG - Intergenic
935297794 2:101665728-101665750 CCTTGGTGTACCGGAAGAATCGG + Intergenic
935663982 2:105494421-105494443 CCTTGGTGTACTAGAAGAATCGG + Intergenic
935813756 2:106826913-106826935 CCTTTGTGGATCAGAACAATCGG + Intronic
937820750 2:126307999-126308021 CCTTGGTGTACTGGAAGAATCGG + Intergenic
937873668 2:126804304-126804326 CCTTGATGTACCAGAAAACTCGG + Intergenic
938030251 2:127986094-127986116 CCTTGGTGTACTGGAAGAATGGG - Intronic
939587267 2:144020430-144020452 CCTTGGTGTACCGGAAGAATCGG - Intronic
939778300 2:146413023-146413045 TCTTACTGTACCAGAAAAATCGG + Intergenic
940360498 2:152791196-152791218 CCTTGGTGTACTGGAAGAATTGG - Intergenic
940478069 2:154191938-154191960 CCTTGGTGTACCAGAAGAATCGG + Intronic
941125219 2:161576409-161576431 CCTTAGTGTACCTGAAAAATCGG - Intronic
941186177 2:162324256-162324278 ACTTGGTATACTGGAAGAATCGG + Intronic
941186905 2:162328775-162328797 CCTTGGTGTACTGGAAAAATCGG + Intronic
941628062 2:167851794-167851816 CCTGGGGGAACCAGAAGCATTGG + Intergenic
941974407 2:171387083-171387105 CCTTGGTGTATGGGAAGAATCGG - Intronic
942327634 2:174789008-174789030 CTTTGCTGTAACTGAAGAATCGG - Intergenic
944728343 2:202495202-202495224 CCTTGGTGTACGGGAAGAGTCGG + Intronic
948159690 2:235813782-235813804 CCTTAGTGTACTGGAAGAATTGG + Intronic
948302650 2:236919673-236919695 CCTTGGTGTACTGGAAGAATTGG + Intergenic
1168754338 20:305601-305623 CCTTGGTGTACCAGAAGAATTGG - Intergenic
1169663384 20:8005953-8005975 CCTTGGTGTACCAGAAGAATCGG - Intronic
1169901932 20:10562218-10562240 CCTTGGTGTACCGGAAATACTGG + Intronic
1170243561 20:14195874-14195896 CCTTGGTGTCCTGGAAGAATCGG - Intronic
1170485964 20:16816608-16816630 CCTTAGTGTACCAGAAGAATCGG + Intergenic
1171072886 20:22092431-22092453 GCCCAGTGTACCAGAAGAATCGG + Intergenic
1171225840 20:23441458-23441480 CCTTGGTGTCCATGAGGAATTGG + Intronic
1171517550 20:25750143-25750165 CCTTGGTGTACTGGAAGAATTGG + Intergenic
1171564177 20:26163188-26163210 CCTTGATGTACTGGAAGAATTGG + Intergenic
1173421638 20:42906458-42906480 CCTTGATATACTGGAAGAATCGG - Intronic
1174126647 20:48311507-48311529 CCTTGGTGTACCTGAAGAATCGG + Intergenic
1174432214 20:50478638-50478660 CCTTGGCGTACCTGAAGAACTGG + Intergenic
1175511284 20:59527940-59527962 CCTTGGTGTACCAGAAGAATCGG - Intergenic
1176933427 21:14841320-14841342 CCTTGGTGTAGTGGAAGAATTGG + Intergenic
1177639895 21:23833151-23833173 CCCTGGTGTACTGGAAGAATTGG + Intergenic
1177644817 21:23887519-23887541 CCTTGGTGTACCAGAAGAATTGG - Intergenic
1179917323 21:44485856-44485878 CCTGGGTGTACCAGAAGAATCGG - Intergenic
1179918067 21:44490805-44490827 CCTGGGTGTACCAGAAGAATCGG - Intergenic
1180930426 22:19586829-19586851 ACTTGGTGTACCGGAAGAATTGG + Intergenic
1180937018 22:19632585-19632607 CCTTGGTGTACCGGAAGAGTCGG + Intergenic
1180969829 22:19809442-19809464 CCTTGGTGTACTGGAAGAATTGG - Intronic
1182265543 22:29112117-29112139 TCTTCGTGGACCAGCAGAATTGG + Intronic
1182684213 22:32108744-32108766 TCTTCATGTATCAGAAGAATTGG - Intronic
1182994724 22:34801571-34801593 CTTAGGTGTACCGGAAGAATTGG - Intergenic
1183134351 22:35872458-35872480 CTTTGGTGTACCAGAAGAATTGG + Intronic
1183227463 22:36560308-36560330 CCATGGAGTGGCAGAAGAATGGG - Intergenic
1184934114 22:47706520-47706542 CCTTGGTGTACTGGAAGAATCGG + Intergenic
1185127054 22:49017175-49017197 CCTTGGTGTACCGGAAGAATCGG + Intergenic
949444144 3:4115344-4115366 CCTTGGTGTACCAGGAAAATCGG - Intronic
949471718 3:4403497-4403519 CCCAGGTGCAGCAGAAGAATGGG + Intronic
949806249 3:7959005-7959027 CCTTGGTGTACCAGAAGAATCGG + Intergenic
951514975 3:23548904-23548926 CCCTGGCATACCAGAAGAACAGG - Intronic
951549402 3:23861882-23861904 CTTTGGCATACCAGAAGAATAGG - Intronic
952564200 3:34635328-34635350 CCTTGGTGTACTGGAAGAATTGG + Intergenic
955480586 3:59385510-59385532 CCTTGGTGTACCAGAAGAATCGG - Intergenic
956194127 3:66635172-66635194 TCTTGGTGTACCAGAAGAATCGG - Intergenic
956511699 3:70000017-70000039 CCTTGGTGTACCGGAAAAATTGG - Intergenic
956778629 3:72587244-72587266 CTTTGGTGTACTGGAAGAATCGG - Intergenic
957547886 3:81663579-81663601 CCTTGGTATACTGGAAGAATAGG - Intronic
957991070 3:87627953-87627975 CCTTGGTGTATGGAAAGAATAGG - Intergenic
958074439 3:88657851-88657873 CCTTAGTGTACCAGAAAAGTCGG + Intergenic
958632915 3:96704027-96704049 GCTTGGTGTACTGGAAGAATTGG - Intergenic
958793339 3:98678861-98678883 CCTTGGTGTCCCAAAACACTAGG + Intergenic
959269718 3:104192252-104192274 CCTTGGTGTACCAGAAGAATCGG + Intergenic
959538858 3:107517926-107517948 CTATGGTGTCCCAGAAGACTTGG - Intergenic
959583448 3:108004541-108004563 CCCTGGTGTATGGGAAGAATCGG - Intergenic
960023938 3:112987734-112987756 CCTTGGTGTACTGGAAGAATCGG + Intergenic
960062813 3:113340817-113340839 CCTTGGTGTACTGGAAGAATCGG + Intronic
960415809 3:117383488-117383510 CCTTGGTGTACCAGAAGAATTGG - Intergenic
960515217 3:118595686-118595708 CCTTGGTGTACCAGAAGAATTGG + Intergenic
960544221 3:118894270-118894292 ACTTGTGGTACCAGAAGATTTGG + Intergenic
963239845 3:142992282-142992304 TCTTGGTGTACCAGAATAATCGG + Intronic
963445154 3:145395806-145395828 CCTTGGTGTACCAGAAGAATCGG - Intergenic
963451835 3:145491507-145491529 ACTTCTTGAACCAGAAGAATAGG + Intergenic
963996990 3:151721307-151721329 CCTTGGTGTACTGGAAGAATTGG + Intergenic
964308015 3:155361606-155361628 CCTTGGCATACTGGAAGAATTGG + Intergenic
965320486 3:167247476-167247498 CCTTGGTGTCCCAGAAGAATTGG - Intronic
965321032 3:167251253-167251275 CCTTGGGGTACCAGAAGAATCGG - Intronic
965433041 3:168612677-168612699 CCTTGGTTTACCAGAAGAATTGG - Intergenic
965534995 3:169814114-169814136 CCTTGGTGTACCGGAAAAATCGG + Intergenic
966285762 3:178293681-178293703 CCTTGGTGTACTGGAAGAGCCGG + Intergenic
968247490 3:197167002-197167024 TCTTGCTGTACCAGAAGATAAGG + Intronic
970234475 4:13944683-13944705 TCTTGGTGTACCGAAAGAATTGG + Intergenic
970576948 4:17437115-17437137 CATTGGTGTACTGGAAGAACTGG + Intergenic
970860961 4:20701709-20701731 CCTTGGTGTCCGTGGAGAATTGG + Intronic
971585641 4:28402651-28402673 CCTTGGTGTACTGGATGAATCGG + Exonic
971986929 4:33838073-33838095 CCTTGATGTACTGGAAGAATTGG - Intergenic
972108555 4:35525557-35525579 CCCTAGTGTACCAGAAAAATCGG + Intergenic
972394826 4:38649779-38649801 CCTTGGTGTACTAGAAAAATTGG - Intergenic
972918453 4:43907241-43907263 CCTTGGTGTACTTAAATAATTGG - Intergenic
972940218 4:44186419-44186441 CCTTGGTGTACCAGAAAAATTGG - Intronic
974596267 4:64017285-64017307 CCCTGGGGTACCAGAAAAATTGG + Intergenic
974974987 4:68880795-68880817 CCTTGGTTTATCAGAAGAATGGG + Intergenic
974983744 4:68993834-68993856 CCTTGGTGTATCAGAAGAATGGG + Intergenic
974993981 4:69129491-69129513 CCTTGGTGTATCAGAAGAATGGG - Intronic
976070623 4:81235996-81236018 CCTTAGTGTACCAGAAGAACTGG + Intergenic
976088495 4:81430355-81430377 CCTCGGTGTACTGGAAGAATCGG - Intronic
976122825 4:81801569-81801591 CCTTTGTTTCCCAGAACAATTGG - Intronic
977045179 4:92060707-92060729 CTTTAGTGTACCAGAAAAATTGG + Intergenic
977756959 4:100682866-100682888 CCTCGGTGTACTGGAAGAATTGG - Intronic
977766596 4:100805944-100805966 CCTTGGTGTACCGGAAGAACTGG + Intronic
978327429 4:107575257-107575279 CCTTGGTGTACAGGAAAAATCGG - Intergenic
979088908 4:116453118-116453140 TCCTGGTGTACCAGAAGAATTGG + Intergenic
979275759 4:118812735-118812757 CCTTGCTGTACTGGAAGAATTGG - Intronic
979862120 4:125707235-125707257 CCTTGGTGTTCCGGAAGAACTGG + Intergenic
980100682 4:128538802-128538824 CCTTGATGTACCGGAAGAATCGG + Intergenic
980286393 4:130783229-130783251 CCTTGGTGTACCAGAAGAATCGG - Intergenic
980330766 4:131408505-131408527 CCTTGGTGTACCAAAAGAATCGG + Intergenic
980485454 4:133451219-133451241 CCTTGGTGTACCGGAAGAATCGG - Intergenic
980716500 4:136636551-136636573 CCTTGGTGTACCAGAAGAATGGG - Intergenic
980717084 4:136640364-136640386 CCTTGGTGTCCTGGAAGAATGGG - Intergenic
981317198 4:143351212-143351234 CCTTGGTGTACCAGAAGAATTGG + Intronic
981423819 4:144581176-144581198 CCTTAGTGTACCGGAAAAATCGG - Intergenic
982504189 4:156197109-156197131 ACTTGGTGTACCTGAAAAATTGG - Intergenic
982947792 4:161648126-161648148 CCTTGGTGTACCGGAAGAATCGG - Intronic
983145950 4:164215130-164215152 CCTTGGTTTACCGGAAGAATTGG + Intronic
984081262 4:175252597-175252619 CCTTGGTGTACTGCAGGAATCGG - Intergenic
984226129 4:177036989-177037011 CCTGGCTCTCCCAGAAGAATAGG - Intergenic
984261261 4:177445422-177445444 CCTTGGTGTACGGGAAGAATTGG - Intergenic
984263583 4:177470690-177470712 CCTTGGTGTACCGGAAGAATCGG + Intergenic
984289843 4:177781562-177781584 CCTTGGTATACTAGAAGAATCGG + Intronic
985273794 4:188218812-188218834 CTTTGGGGTACCTGAAGAATCGG + Intergenic
985854869 5:2416888-2416910 CCTTAATGTACCAGAAAAATTGG - Intergenic
986165260 5:5267355-5267377 CCTTGGTGTGCTGGAAAAATTGG + Intronic
986425046 5:7622955-7622977 CCTTGTTGTAACAGAACAGTTGG - Intronic
987212154 5:15693929-15693951 CCCTAGTGTACCGGAAAAATTGG - Intronic
988038091 5:25853387-25853409 CCTTGGTGTACCAGAAGAATCGG + Intergenic
988086773 5:26484162-26484184 CTTTGGTGTACCGGAAGAATCGG - Intergenic
988205352 5:28126604-28126626 CCTTAGTGTACCGGAAAAATTGG - Intergenic
990637977 5:57750674-57750696 CCTAGGTATACCGGAAGAATCGG + Intergenic
992093664 5:73340696-73340718 CCTTGATGTATCAGAAGAATTGG - Intergenic
992256694 5:74928585-74928607 CCTTTGTGAACCAGAGAAATAGG - Intergenic
994329719 5:98490718-98490740 CCTTGGTGTACTGGAAGAACTGG - Intergenic
994871189 5:105351786-105351808 CCTTGGTGTACCACAAGAATCGG + Intergenic
994884983 5:105548991-105549013 CCTTGGTCTACTGGAAGAATTGG + Intergenic
994929525 5:106163594-106163616 CCTTGGTATACCAGAAGAATCGG - Intergenic
995550416 5:113275855-113275877 CCTTGGTGTTCAAGGGGAATTGG - Intronic
995979030 5:118078931-118078953 CCTTCGTATACCAGAATAATCGG - Intergenic
996215551 5:120860933-120860955 CCTTGGTATACCTGGAGGATTGG - Intergenic
997139254 5:131361645-131361667 CTTTGGTGTGCTAGAAGAATTGG + Intronic
999007279 5:147996724-147996746 CCTTGGTGTAACAAAAGAATTGG + Intergenic
999536988 5:152528590-152528612 CCCTGGTGTACCGAAACAATGGG + Intergenic
999927241 5:156392637-156392659 CCTTGGTGTCCCGGAAGAATTGG + Intronic
1000167912 5:158673175-158673197 CCTTGGTGTTCTGGAAGAATCGG + Intergenic
1000516432 5:162241137-162241159 CCTTGGTGCACCAGCAAAATTGG + Intergenic
1000541893 5:162550631-162550653 CCTTGGAGTACTGGAAGAATCGG - Intergenic
1001181163 5:169521971-169521993 CCTTGGTGTACCAGAAGAATTGG - Intergenic
1001454028 5:171847141-171847163 CCTTGATTTCCCAGAAGAAAAGG + Intergenic
1001940131 5:175734422-175734444 TCTTGCTGTACCGGAAGAATGGG - Intergenic
1002271356 5:178074615-178074637 CTTTGGTGTAGCGGAAGAATTGG - Intergenic
1002475696 5:179464491-179464513 CCCTGGTGTACCAGAAAAATTGG + Intergenic
1002476979 5:179472583-179472605 CCTTGGTGTCCCGGAAGAATCGG + Intergenic
1002843363 6:924631-924653 CCTTAGTTTACTGGAAGAATTGG - Intergenic
1003069916 6:2937979-2938001 CCTTGGTGTACCAGAAGAATCGG + Intergenic
1003131233 6:3396878-3396900 CCTTGGTGTACCAGAAGAATCGG - Intronic
1003396339 6:5756022-5756044 CCTTGATGTAACAGCAGACTAGG - Intronic
1003809891 6:9767905-9767927 CCTTGGTGTGCTGGAAGAATCGG + Intronic
1004027293 6:11831620-11831642 CCTTAGTGGACTGGAAGAATCGG + Intergenic
1004417239 6:15436210-15436232 CCTTGGTGTATCAGAAGAATCGG + Intronic
1004799927 6:19134904-19134926 GCCCAGTGTACCAGAAGAATTGG - Intergenic
1004980508 6:21018123-21018145 ATTTGGTGTACCAGCAGAAAGGG + Intronic
1005029352 6:21494452-21494474 CCTTGGTGTACCAGAAAAATCGG - Intergenic
1005712217 6:28513196-28513218 CCTTGGTTTACGAGAAGAATCGG - Intronic
1006731031 6:36236234-36236256 CCTTGGTGTACCAGAAAAATAGG - Intergenic
1007194385 6:40048013-40048035 CCTTGGGTTATCAGAAGAAAAGG - Intergenic
1007676058 6:43595863-43595885 CCTTGGTGTTTCAGGAAAATAGG - Intronic
1008459616 6:51753138-51753160 TCTGGGTGTCCCAGATGAATAGG + Intronic
1008727649 6:54441622-54441644 GCTTGGTGTATGGGAAGAATTGG + Intergenic
1009496575 6:64356397-64356419 CATTGGTGTCCCATAAGAGTTGG + Intronic
1010028355 6:71245651-71245673 CCCTAGTGTACCAGAAAAATCGG + Intergenic
1010503977 6:76633664-76633686 CCTTGGTGCACTGGAAGAATCGG + Intergenic
1010519051 6:76810252-76810274 CCCCAGTGTACCAGAAGAATCGG - Intergenic
1010532727 6:76988856-76988878 CCTTCATGTACCGGAAAAATTGG - Intergenic
1010687354 6:78868067-78868089 CCTTCGTCTAGGAGAAGAATGGG - Intronic
1010995160 6:82523995-82524017 CTTTGGTGTACTGGGAGAATCGG - Intergenic
1011639605 6:89406672-89406694 CCTTGGTGTACCGGAAGAATCGG - Intronic
1011873492 6:91926792-91926814 CCTTGGTGTACCGGAAGAATTGG + Intergenic
1012274393 6:97254556-97254578 CCATGGAGTACCAGATGAAATGG - Exonic
1012330493 6:97979303-97979325 CCTTGGTGTACCGGAAGAATCGG - Intergenic
1012440212 6:99255264-99255286 CTTTGGTGTACCGGAAGAATCGG - Intergenic
1012606823 6:101168015-101168037 CCTTGGTGTACCAAAAGAATCGG - Intergenic
1013113028 6:107079342-107079364 CCTTGGTGTACCAGAAGAATCGG - Intronic
1013946484 6:115728533-115728555 CCTTGGTGTACCAGAAGAATTGG - Intergenic
1014247233 6:119081597-119081619 CCTTGGTGTACTGGAAGAATTGG + Intronic
1014447624 6:121546995-121547017 CCTTGGTGTACCATAAGAATTGG + Intergenic
1014492745 6:122082383-122082405 CCTTGATGTACCGGAAGAATCGG + Intergenic
1014717980 6:124887878-124887900 CCTTAGTGTACGGGTAGAATCGG - Intergenic
1015729627 6:136334830-136334852 CCTTGGTGTACCAGAGGAATCGG - Intergenic
1016021018 6:139236136-139236158 CCTTAGTGTACCAGAAAAATTGG - Intergenic
1016109597 6:140206162-140206184 CCTTGGTGTACTGGAAGAATTGG - Intergenic
1016540787 6:145161447-145161469 CCTTGGGGCACCAGAAGCTTGGG + Intergenic
1016575338 6:145563904-145563926 CCTTGGTATCCCTGAGGAATCGG + Intronic
1018258010 6:161941516-161941538 CCTTTGTGTACCAGAAGAATCGG - Intronic
1018620418 6:165725211-165725233 CCTTAGTGTACCAGAAAAATCGG - Intronic
1018843059 6:167532281-167532303 CCTTGGTGTACTGGAAGAATCGG - Intergenic
1019136575 6:169912251-169912273 CCCTGGTGTACCAGAAGAATCGG - Intergenic
1019956820 7:4422233-4422255 CCTTGGATTACCAGAAGGAGAGG - Intergenic
1021009418 7:15443119-15443141 CCTTGGTGTACCAGAAGAATTGG - Intronic
1023055797 7:36288839-36288861 ACTTGGTTTACCAAAAGAAAAGG + Intronic
1023253604 7:38291083-38291105 CCTTGGTGTACTGAAAGAATTGG - Intergenic
1024268116 7:47622012-47622034 TCTTGGTGTACCGGAAGAATTGG + Intergenic
1024643853 7:51355333-51355355 CCTTAGTGTACTGGAAAAATCGG + Intergenic
1024841346 7:53590992-53591014 CCTTAGTGTACCAGAAAAATCGG + Intergenic
1024845054 7:53633355-53633377 CCTTGATGTACGGGAAGAATCGG + Intergenic
1025273548 7:57551028-57551050 CCTTGATGTACTGGAAGAATTGG - Intergenic
1025820208 7:64955652-64955674 CCTTGGTGTACCAGAATAATCGG - Intergenic
1026055663 7:66981491-66981513 CCTTGGCATCCCAGAAGGATGGG + Intergenic
1026111050 7:67459211-67459233 CCCTAGTGGACCAGAAAAATCGG + Intergenic
1026248424 7:68645008-68645030 CCCTAGTGTACCAGAAAAATCGG - Intergenic
1026467356 7:70665864-70665886 CCTTGGTATATGTGAAGAATTGG - Intronic
1026722031 7:72840317-72840339 CCTTGGCATCCCAGAAGGATGGG - Intergenic
1027932289 7:84552864-84552886 CCTTAGTGTACTGGCAGAATCGG - Intergenic
1029033226 7:97490682-97490704 CCTTTGTGTACCGGAAGAATCGG - Intergenic
1029038664 7:97549839-97549861 CCTTGGTGTACCGGAAGAATCGG - Intergenic
1030746575 7:113173129-113173151 CCTTAGTGTACCAGAAAAATCGG - Intergenic
1030769529 7:113456958-113456980 CTTTGGTGTACCAGAAGAATCGG - Intergenic
1030794401 7:113770207-113770229 CCTTGGTGTACTAGAAGAATCGG + Intergenic
1031219454 7:118946005-118946027 CCTTGGTGCACTGGAAGAATTGG - Intergenic
1031750381 7:125564022-125564044 CCCTACTGTACCAGAAAAATCGG - Intergenic
1032673309 7:134106072-134106094 CCTTAGTGTACTGGAAAAATTGG + Intergenic
1033049281 7:137989494-137989516 CCTGGGGGCACCAGAAGGATTGG - Intronic
1033970601 7:147034601-147034623 CCTTGGTGTATCAGAAAAATCGG + Intronic
1034051707 7:147990747-147990769 CACTGGTGTACCAGAAGAGTAGG - Intronic
1034099261 7:148437223-148437245 CCTTGGTGTACTGGAAGAACTGG + Intergenic
1034931317 7:155166096-155166118 CCTTAGTGTACTGGAAAAATTGG - Intergenic
1038248608 8:25882012-25882034 CTTTGGTGTACCAGAAGAATTGG - Intronic
1039075869 8:33689915-33689937 TCCCAGTGTACCAGAAGAATTGG - Intergenic
1039389992 8:37171775-37171797 CCTTGGTGCACCGGAGGAATCGG + Intergenic
1039865667 8:41499401-41499423 CCTTGGTGTACCAGAAGAATCGG + Intronic
1040782131 8:51121880-51121902 CCTTAGTGTACAGGAAAAATCGG - Intergenic
1041586270 8:59523575-59523597 CCTTGGTGTACTGTAATAATTGG - Intergenic
1041934732 8:63322525-63322547 CCTTGGTGTACCAGAAGAATCGG - Intergenic
1042506321 8:69564833-69564855 ACTAGGTGGACTAGAAGAATTGG - Intronic
1042598211 8:70471834-70471856 CCCTGGCTTACCTGAAGAATCGG - Intergenic
1043238445 8:77899614-77899636 CTTTGGTGTACTGGAAGAATTGG + Intergenic
1043605271 8:81991639-81991661 CCTTGGTGTACTTGAAGAATTGG + Intergenic
1044639451 8:94363183-94363205 CCTTGGTGTCCCAGAATGCTGGG - Intergenic
1046138344 8:110060321-110060343 CTTTGGTGTACTAGAAGAATCGG - Intergenic
1046138929 8:110064136-110064158 CCTTGGTGTACTAGAAGAATGGG - Intergenic
1046142718 8:110115979-110116001 CCTTGGTGTACCAGAAGAATCGG - Intergenic
1046229503 8:111335052-111335074 TCTTGGCGTACCGGAAGAATCGG + Intergenic
1046250450 8:111624149-111624171 CCTTGGTGTACCAGAAGAATCGG + Intergenic
1046439233 8:114236718-114236740 TCTTGGTGTACGGGAAAAATCGG - Intergenic
1047313663 8:123712954-123712976 CCTTGGATGACCAGGAGAATGGG + Intronic
1047640892 8:126820793-126820815 CCTTGGTGTACCAGAAGAATCGG + Intergenic
1047883171 8:129218677-129218699 CCTTAGTGTAACAGAAAAATCGG - Intergenic
1048671700 8:136730199-136730221 CCTTGGTGTACCGGAAGAATTGG + Intergenic
1049726994 8:144151588-144151610 CTTTGGTGTACCGGCAGAGTCGG - Intronic
1050043631 9:1521184-1521206 CCTTGGTGTACCAGAAGAATCGG - Intergenic
1050342470 9:4654558-4654580 CCTTGGTGTACTGGAAGAATAGG + Intronic
1050784832 9:9388025-9388047 CCTTGCTGTACTGGAAGAATTGG + Intronic
1050900828 9:10947048-10947070 CTCTGGTGTACAGGAAGAATCGG + Intergenic
1050944560 9:11500762-11500784 CCTTGGTGTACTGGAAGAATCGG + Intergenic
1051144087 9:14007875-14007897 CCTCGGTGTACTGGAAGAATTGG - Intergenic
1051737982 9:20222250-20222272 TATTGGTGTACCAGAAGAAAGGG + Intergenic
1052122713 9:24738296-24738318 CCTTAGTGTACTGGAAGAATGGG - Intergenic
1052134967 9:24898178-24898200 CCTTGGTGTACCGCAAGAATCGG - Intergenic
1052370149 9:27655229-27655251 CCTTGGTGTACCGGAAGAATCGG - Intergenic
1052690388 9:31809205-31809227 CTTTGGTGTACGGGAAGAATTGG + Intergenic
1052778390 9:32755727-32755749 CCTTGGTGTACCGGAAGAATCGG + Intergenic
1053032855 9:34797375-34797397 CCTTGGTGTACCAGAAGAATTGG + Intergenic
1055199799 9:73646463-73646485 CCTTGGTGTACCGGAAGAATCGG + Intergenic
1055538815 9:77279151-77279173 GCCCAGTGTACCAGAAGAATTGG + Intronic
1055734469 9:79312622-79312644 CCTTGGTGTACCAGAAGAGTAGG - Intergenic
1056871926 9:90289718-90289740 CCCTAGTGTACAAGAAAAATTGG - Intergenic
1058236585 9:102498032-102498054 CTCTAGTGTACCAGAAAAATCGG + Intergenic
1058296883 9:103319673-103319695 CCTTGGGGTTCCATAGGAATGGG - Intergenic
1058311920 9:103514760-103514782 CCTTGGTGGACCAGAAGAACTGG + Intergenic
1058584455 9:106492158-106492180 CCTTGCTTTACCAGAAGAATAGG + Intergenic
1203625234 Un_KI270750v1:11674-11696 CCTTGATGTACTGGAAGAATTGG - Intergenic
1186178293 X:6948130-6948152 CTTTTGTGTACTAGGAGAATGGG - Intergenic
1186383430 X:9085265-9085287 CCTTGGTGTCCGTGGAGAATTGG - Intronic
1186818774 X:13264888-13264910 ACTTGCTGTTCCAGAAGTATTGG - Intergenic
1187138538 X:16571225-16571247 CCTTAGTGTACTGGAAAAATCGG - Intergenic
1187707852 X:22025360-22025382 CCTCAGTGTCCCAAAAGAATCGG + Intergenic
1188246314 X:27840100-27840122 CCAGGGAGTACCAGAATAATGGG + Intergenic
1189001825 X:36956241-36956263 TCTTGAGGTAACAGAAGAATAGG - Intergenic
1189083933 X:38000691-38000713 CCTTGGTGTACTGGAAGAATCGG + Intronic
1189413087 X:40791122-40791144 GCCCAGTGTACCAGAAGAATCGG + Intergenic
1189642256 X:43085703-43085725 CCTTGGTGTACTGGAAGAATCGG + Intergenic
1189833342 X:44997212-44997234 CCTTGGTGTACTGGAAGAATCGG + Intronic
1190766684 X:53481050-53481072 CCTTGGTGTACTGGAAGAACCGG - Intergenic
1191146064 X:57166273-57166295 TCTTAGTGTACCAGAAAAATCGG - Intergenic
1191939634 X:66464082-66464104 GCTCAATGTACCAGAAGAATCGG + Intergenic
1192748483 X:73963709-73963731 CCTTGTTGTACTGGAAGAATTGG + Intergenic
1193183615 X:78486811-78486833 CCTTGGTGTACTGGAAGAATTGG + Intergenic
1193254560 X:79331866-79331888 TCTTGGTGAAGCAGGAGAATAGG - Intergenic
1193358412 X:80551069-80551091 CCTTGGTGTACTGGAAGAATTGG + Intergenic
1193416365 X:81229441-81229463 CCTTGGTGTACCAGAAGAATCGG + Intronic
1193511036 X:82400080-82400102 CCTTAGTGTACTGGAAAAATTGG + Intergenic
1193702458 X:84779831-84779853 CCTTGATGTACCCAAAGAATTGG + Intergenic
1193836322 X:86349090-86349112 CCTTGGTGTACCAGAAGAATTGG + Intronic
1194054134 X:89109994-89110016 CCTTGGTGTCCCGGAATTATTGG + Intergenic
1194068253 X:89288297-89288319 CCTTGGAGTACGGGAAGAATTGG + Intergenic
1194221637 X:91200452-91200474 CCTTGGTGTACCGGAATAATTGG - Intergenic
1194298304 X:92154888-92154910 CCTTGGTGTACGGGAAGAATCGG - Intronic
1194535661 X:95103466-95103488 CCTTGGTGTACTGAACGAATTGG + Intergenic
1195334404 X:103835825-103835847 CCTTGGTGTAACAAAGGAGTTGG + Intergenic
1196006663 X:110843993-110844015 CCTTAGTGTACAGGAAAAATTGG - Intergenic
1196008360 X:110859268-110859290 ACTTGGTGTACTAGAGGACTAGG + Intergenic
1196197466 X:112851211-112851233 CCTTGGTGTAAAAGTAGCATTGG + Intergenic
1196271439 X:113716434-113716456 CCCTAGTGTACCAGACAAATTGG - Intergenic
1196281517 X:113828551-113828573 CCTTGGTGTACCAGAAGAATTGG - Intergenic
1197459625 X:126724229-126724251 GCTTGGTGTACTGGAAGAATCGG - Intergenic
1198167547 X:134072303-134072325 CCTTAGTGTACTGGAAGAATCGG + Intergenic
1198271009 X:135056004-135056026 TCTTGTTGTACTGGAAGAATTGG - Intergenic
1198386597 X:136134899-136134921 CCTTGGTGTACCAGAAGAACCGG + Intergenic
1198711395 X:139508100-139508122 CCTTGGTGTACTGGAAAAATCGG - Intergenic
1198964286 X:142210842-142210864 CCTTGGTGTACTGGAAGAATCGG - Intergenic
1199069794 X:143462711-143462733 AGTTGGTGTATCAGAAAAATCGG - Intergenic
1199267897 X:145849281-145849303 CCTTGGTGTACTGGAAGAATTGG + Intergenic
1199580049 X:149351764-149351786 CCCTAGTGTACCAGAAAAATTGG + Intergenic
1200558152 Y:4664208-4664230 CCTTGGTGTACCGGAATAATTGG - Intergenic
1200615912 Y:5379848-5379870 CCTTGGTGTACGGGAAGAATCGG - Intronic
1200690369 Y:6302989-6303011 CCTTGGTGTACCTGAAGAATTGG + Intergenic
1200710113 Y:6475788-6475810 CTTTGCTGTACCTGAAAAATTGG + Intergenic
1200722396 Y:6622466-6622488 CCTTGGAGTACGGGAAGAATTGG + Intergenic
1200788034 Y:7275789-7275811 CCATGGGGGACCAGAAGAAGAGG - Intergenic
1200883062 Y:8240877-8240899 CCTTGGTGTACCTGAAGAATTGG + Intergenic
1200883534 Y:8245522-8245544 CCTTGGTGTACCTGAAGAATTGG + Intergenic
1200910072 Y:8524056-8524078 CTTTGGTGTACCTGAAGAATTGG - Intergenic
1200955198 Y:8937610-8937632 CTTTGTTGTAGCTGAAGAATTGG - Intergenic
1200960213 Y:8989567-8989589 CCTGGATGTACCTGAAAAATTGG - Intergenic
1201024002 Y:9688920-9688942 CTTTGCTGTACCTGAAAAATTGG - Intergenic
1201044904 Y:9871727-9871749 CCTTGGTGTACCTGAAGAATTGG - Intergenic
1201060920 Y:10046181-10046203 CCTTGTTGTACCTGAAGAATTGG + Intergenic
1201307524 Y:12563541-12563563 CCAAGGTGTACCAGAAGAGTAGG - Intergenic
1201412359 Y:13713114-13713136 CCTTGGTGTATTGGAAGAATTGG + Intergenic
1202111104 Y:21421616-21421638 CCTTGGTGTACCTGAAGAATTGG + Intergenic
1202117367 Y:21482538-21482560 CCTTGGTGAACCTGAAGAAATGG - Intergenic
1202183580 Y:22159962-22159984 CCTTGGTGTACCTGAAGAATTGG + Intergenic
1202194980 Y:22291106-22291128 CCTTGGTGTACCTGAAAAATTGG + Intergenic
1202200021 Y:22336325-22336347 CCTTGGTGTACCTGAAAAATTGG - Intronic
1202207779 Y:22426439-22426461 CCTTGGTGTACCTGAAGAATTGG - Intergenic
1202233336 Y:22678852-22678874 CCTTGGTGTAGCTGAAGAATTGG - Intergenic
1202309820 Y:23517306-23517328 CCTTGGTGTAGCTGAAGAATTGG + Intergenic
1202560981 Y:26153287-26153309 CCTTGGTGTAGCTGAAGAATTGG - Intergenic