ID: 1112818489

View in Genome Browser
Species Human (GRCh38)
Location 13:103302052-103302074
Sequence TAGGTACAGCAAGCAGAGAT GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1112818484_1112818489 19 Left 1112818484 13:103302010-103302032 CCCTTGGCTGTTGCAAAACAAAA No data
Right 1112818489 13:103302052-103302074 TAGGTACAGCAAGCAGAGATGGG No data
1112818485_1112818489 18 Left 1112818485 13:103302011-103302033 CCTTGGCTGTTGCAAAACAAAAG No data
Right 1112818489 13:103302052-103302074 TAGGTACAGCAAGCAGAGATGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1112818489 Original CRISPR TAGGTACAGCAAGCAGAGAT GGG Intergenic
No off target data available for this crispr