ID: 1112823054

View in Genome Browser
Species Human (GRCh38)
Location 13:103357989-103358011
Sequence GCTTAGGACTGAGCTGGTAC TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1112823049_1112823054 7 Left 1112823049 13:103357959-103357981 CCTTCTTTAGCTAATCTAGAACC No data
Right 1112823054 13:103357989-103358011 GCTTAGGACTGAGCTGGTACTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1112823054 Original CRISPR GCTTAGGACTGAGCTGGTAC TGG Intergenic
No off target data available for this crispr