ID: 1112833969

View in Genome Browser
Species Human (GRCh38)
Location 13:103490977-103490999
Sequence CCACCTTGTGTGATTAAGTC TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1112833965_1112833969 20 Left 1112833965 13:103490934-103490956 CCAACTGGAGTGAGAACATAGGA No data
Right 1112833969 13:103490977-103490999 CCACCTTGTGTGATTAAGTCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1112833969 Original CRISPR CCACCTTGTGTGATTAAGTC TGG Intergenic
No off target data available for this crispr