ID: 1112834493

View in Genome Browser
Species Human (GRCh38)
Location 13:103497633-103497655
Sequence CTTTATAAGAGGGAGGTGGA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1112834493_1112834499 -2 Left 1112834493 13:103497633-103497655 CCTTCCACCTCCCTCTTATAAAG No data
Right 1112834499 13:103497654-103497676 AGGACCCCTGTGATTGCATCAGG No data
1112834493_1112834503 17 Left 1112834493 13:103497633-103497655 CCTTCCACCTCCCTCTTATAAAG No data
Right 1112834503 13:103497673-103497695 CAGGCTCACCTGAGTAATCCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1112834493 Original CRISPR CTTTATAAGAGGGAGGTGGA AGG (reversed) Intergenic
No off target data available for this crispr