ID: 1112838092

View in Genome Browser
Species Human (GRCh38)
Location 13:103541561-103541583
Sequence GAATCAATTTCATCAAGGCC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1112838092_1112838094 5 Left 1112838092 13:103541561-103541583 CCAGGCCTTGATGAAATTGATTC No data
Right 1112838094 13:103541589-103541611 TTTGAAAGTTTCATGCACTATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1112838092 Original CRISPR GAATCAATTTCATCAAGGCC TGG (reversed) Intergenic
No off target data available for this crispr