ID: 1112839714

View in Genome Browser
Species Human (GRCh38)
Location 13:103561345-103561367
Sequence CTATCAGTACATCTGCAACT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1112839714_1112839718 9 Left 1112839714 13:103561345-103561367 CCCAGTTGCAGATGTACTGATAG No data
Right 1112839718 13:103561377-103561399 GTACATAGTTTTTTACTTAATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1112839714 Original CRISPR CTATCAGTACATCTGCAACT GGG (reversed) Intergenic
No off target data available for this crispr