ID: 1112854127

View in Genome Browser
Species Human (GRCh38)
Location 13:103745538-103745560
Sequence CTCTTCAGTGATAGTTAGTC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1112854127_1112854129 12 Left 1112854127 13:103745538-103745560 CCAGACTAACTATCACTGAAGAG No data
Right 1112854129 13:103745573-103745595 ATTATTTTAACTTTTATCTAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1112854127 Original CRISPR CTCTTCAGTGATAGTTAGTC TGG (reversed) Intergenic
No off target data available for this crispr