ID: 1112856328

View in Genome Browser
Species Human (GRCh38)
Location 13:103774145-103774167
Sequence CTAGAATCCTGGGCTCAAAA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1112856328_1112856333 19 Left 1112856328 13:103774145-103774167 CCCTTTTGAGCCCAGGATTCTAG No data
Right 1112856333 13:103774187-103774209 ATCTAGTTGTGTATCATAAAGGG No data
1112856328_1112856334 20 Left 1112856328 13:103774145-103774167 CCCTTTTGAGCCCAGGATTCTAG No data
Right 1112856334 13:103774188-103774210 TCTAGTTGTGTATCATAAAGGGG No data
1112856328_1112856332 18 Left 1112856328 13:103774145-103774167 CCCTTTTGAGCCCAGGATTCTAG No data
Right 1112856332 13:103774186-103774208 TATCTAGTTGTGTATCATAAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1112856328 Original CRISPR CTAGAATCCTGGGCTCAAAA GGG (reversed) Intergenic
No off target data available for this crispr