ID: 1112859015

View in Genome Browser
Species Human (GRCh38)
Location 13:103807793-103807815
Sequence CAAAATGCTGGTAGTTACAT GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1112859010_1112859015 5 Left 1112859010 13:103807765-103807787 CCCTGGAGAATTGTTGAATGGCT No data
Right 1112859015 13:103807793-103807815 CAAAATGCTGGTAGTTACATGGG No data
1112859011_1112859015 4 Left 1112859011 13:103807766-103807788 CCTGGAGAATTGTTGAATGGCTT No data
Right 1112859015 13:103807793-103807815 CAAAATGCTGGTAGTTACATGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1112859015 Original CRISPR CAAAATGCTGGTAGTTACAT GGG Intergenic
No off target data available for this crispr