ID: 1112862493

View in Genome Browser
Species Human (GRCh38)
Location 13:103849873-103849895
Sequence AGAAAGAAAATGCATCTGCC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1112862493_1112862499 26 Left 1112862493 13:103849873-103849895 CCTGGCAGATGCATTTTCTTTCT No data
Right 1112862499 13:103849922-103849944 ACAGGGCGAACCATGGGAAGTGG No data
1112862493_1112862500 27 Left 1112862493 13:103849873-103849895 CCTGGCAGATGCATTTTCTTTCT No data
Right 1112862500 13:103849923-103849945 CAGGGCGAACCATGGGAAGTGGG No data
1112862493_1112862496 9 Left 1112862493 13:103849873-103849895 CCTGGCAGATGCATTTTCTTTCT No data
Right 1112862496 13:103849905-103849927 CAGGTAAATTGAGTTGCACAGGG No data
1112862493_1112862498 20 Left 1112862493 13:103849873-103849895 CCTGGCAGATGCATTTTCTTTCT No data
Right 1112862498 13:103849916-103849938 AGTTGCACAGGGCGAACCATGGG No data
1112862493_1112862495 8 Left 1112862493 13:103849873-103849895 CCTGGCAGATGCATTTTCTTTCT No data
Right 1112862495 13:103849904-103849926 GCAGGTAAATTGAGTTGCACAGG No data
1112862493_1112862497 19 Left 1112862493 13:103849873-103849895 CCTGGCAGATGCATTTTCTTTCT No data
Right 1112862497 13:103849915-103849937 GAGTTGCACAGGGCGAACCATGG No data
1112862493_1112862494 -10 Left 1112862493 13:103849873-103849895 CCTGGCAGATGCATTTTCTTTCT No data
Right 1112862494 13:103849886-103849908 TTTTCTTTCTACTAGCGAGCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1112862493 Original CRISPR AGAAAGAAAATGCATCTGCC AGG (reversed) Intergenic
No off target data available for this crispr