ID: 1112862500

View in Genome Browser
Species Human (GRCh38)
Location 13:103849923-103849945
Sequence CAGGGCGAACCATGGGAAGT GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1112862493_1112862500 27 Left 1112862493 13:103849873-103849895 CCTGGCAGATGCATTTTCTTTCT No data
Right 1112862500 13:103849923-103849945 CAGGGCGAACCATGGGAAGTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1112862500 Original CRISPR CAGGGCGAACCATGGGAAGT GGG Intergenic
No off target data available for this crispr