ID: 1112870312

View in Genome Browser
Species Human (GRCh38)
Location 13:103962873-103962895
Sequence GAACCCTTTGAGAACCCATG TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1112870312_1112870313 26 Left 1112870312 13:103962873-103962895 CCACATGGGTTCTCAAAGGGTTC No data
Right 1112870313 13:103962922-103962944 AATAATCAGCCTACTCTTTCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1112870312 Original CRISPR GAACCCTTTGAGAACCCATG TGG (reversed) Intergenic
No off target data available for this crispr