ID: 1112874007

View in Genome Browser
Species Human (GRCh38)
Location 13:104013071-104013093
Sequence ATTATTAATGACGTTTTAGA AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1112874006_1112874007 4 Left 1112874006 13:104013044-104013066 CCTTTCTAATGACTATTTTGCAT No data
Right 1112874007 13:104013071-104013093 ATTATTAATGACGTTTTAGAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1112874007 Original CRISPR ATTATTAATGACGTTTTAGA AGG Intergenic
No off target data available for this crispr