ID: 1112877785

View in Genome Browser
Species Human (GRCh38)
Location 13:104066692-104066714
Sequence GCATGTGCACGGGTGCGCTT AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1112877785_1112877788 13 Left 1112877785 13:104066692-104066714 CCTAAGCGCACCCGTGCACATGC No data
Right 1112877788 13:104066728-104066750 CATACACACATACACACGAGTGG No data
1112877785_1112877791 25 Left 1112877785 13:104066692-104066714 CCTAAGCGCACCCGTGCACATGC No data
Right 1112877791 13:104066740-104066762 CACACGAGTGGCTGGGAAACCGG No data
1112877785_1112877789 17 Left 1112877785 13:104066692-104066714 CCTAAGCGCACCCGTGCACATGC No data
Right 1112877789 13:104066732-104066754 CACACATACACACGAGTGGCTGG No data
1112877785_1112877790 18 Left 1112877785 13:104066692-104066714 CCTAAGCGCACCCGTGCACATGC No data
Right 1112877790 13:104066733-104066755 ACACATACACACGAGTGGCTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1112877785 Original CRISPR GCATGTGCACGGGTGCGCTT AGG (reversed) Intergenic
No off target data available for this crispr