ID: 1112877790

View in Genome Browser
Species Human (GRCh38)
Location 13:104066733-104066755
Sequence ACACATACACACGAGTGGCT GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1112877785_1112877790 18 Left 1112877785 13:104066692-104066714 CCTAAGCGCACCCGTGCACATGC No data
Right 1112877790 13:104066733-104066755 ACACATACACACGAGTGGCTGGG No data
1112877787_1112877790 7 Left 1112877787 13:104066703-104066725 CCGTGCACATGCACACATACACA No data
Right 1112877790 13:104066733-104066755 ACACATACACACGAGTGGCTGGG No data
1112877786_1112877790 8 Left 1112877786 13:104066702-104066724 CCCGTGCACATGCACACATACAC No data
Right 1112877790 13:104066733-104066755 ACACATACACACGAGTGGCTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1112877790 Original CRISPR ACACATACACACGAGTGGCT GGG Intergenic
No off target data available for this crispr