ID: 1112877791

View in Genome Browser
Species Human (GRCh38)
Location 13:104066740-104066762
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1112877786_1112877791 15 Left 1112877786 13:104066702-104066724 CCCGTGCACATGCACACATACAC No data
Right 1112877791 13:104066740-104066762 CACACGAGTGGCTGGGAAACCGG No data
1112877785_1112877791 25 Left 1112877785 13:104066692-104066714 CCTAAGCGCACCCGTGCACATGC No data
Right 1112877791 13:104066740-104066762 CACACGAGTGGCTGGGAAACCGG No data
1112877787_1112877791 14 Left 1112877787 13:104066703-104066725 CCGTGCACATGCACACATACACA No data
Right 1112877791 13:104066740-104066762 CACACGAGTGGCTGGGAAACCGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1112877791 Original CRISPR CACACGAGTGGCTGGGAAAC CGG Intergenic
No off target data available for this crispr