ID: 1112881466

View in Genome Browser
Species Human (GRCh38)
Location 13:104110753-104110775
Sequence TAATTCCTTCTGATTTCCTC TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1112881460_1112881466 26 Left 1112881460 13:104110704-104110726 CCCAAAGCCAGCACAACTTGAAA No data
Right 1112881466 13:104110753-104110775 TAATTCCTTCTGATTTCCTCTGG No data
1112881461_1112881466 25 Left 1112881461 13:104110705-104110727 CCAAAGCCAGCACAACTTGAAAA No data
Right 1112881466 13:104110753-104110775 TAATTCCTTCTGATTTCCTCTGG No data
1112881462_1112881466 19 Left 1112881462 13:104110711-104110733 CCAGCACAACTTGAAAATTTCCT No data
Right 1112881466 13:104110753-104110775 TAATTCCTTCTGATTTCCTCTGG No data
1112881463_1112881466 -1 Left 1112881463 13:104110731-104110753 CCTGAAGTTAACCCATCAAACTT No data
Right 1112881466 13:104110753-104110775 TAATTCCTTCTGATTTCCTCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1112881466 Original CRISPR TAATTCCTTCTGATTTCCTC TGG Intergenic
No off target data available for this crispr