ID: 1112881566

View in Genome Browser
Species Human (GRCh38)
Location 13:104112834-104112856
Sequence AGTTATAAAAATAATGAGGT TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1112881566_1112881571 11 Left 1112881566 13:104112834-104112856 CCAACCTCATTATTTTTATAACT No data
Right 1112881571 13:104112868-104112890 GGTGGACTTAAAAAGTGAAAAGG No data
1112881566_1112881568 -10 Left 1112881566 13:104112834-104112856 CCAACCTCATTATTTTTATAACT No data
Right 1112881568 13:104112847-104112869 TTTTATAACTAGAGATGACCTGG No data
1112881566_1112881569 -7 Left 1112881566 13:104112834-104112856 CCAACCTCATTATTTTTATAACT No data
Right 1112881569 13:104112850-104112872 TATAACTAGAGATGACCTGGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1112881566 Original CRISPR AGTTATAAAAATAATGAGGT TGG (reversed) Intergenic
No off target data available for this crispr