ID: 1112882664

View in Genome Browser
Species Human (GRCh38)
Location 13:104127087-104127109
Sequence GGTAATAAGTTTATAACTGT AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1112882662_1112882664 17 Left 1112882662 13:104127047-104127069 CCTGTGAATATGAACTTGATGTG No data
Right 1112882664 13:104127087-104127109 GGTAATAAGTTTATAACTGTAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1112882664 Original CRISPR GGTAATAAGTTTATAACTGT AGG Intergenic
No off target data available for this crispr