ID: 1112883050

View in Genome Browser
Species Human (GRCh38)
Location 13:104133278-104133300
Sequence CTGAAGTCACAGAAGAAATC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1112883050_1112883054 14 Left 1112883050 13:104133278-104133300 CCTGATTTCTTCTGTGACTTCAG No data
Right 1112883054 13:104133315-104133337 TCCAGTTAGAAATTTTTATCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1112883050 Original CRISPR CTGAAGTCACAGAAGAAATC AGG (reversed) Intergenic
No off target data available for this crispr