ID: 1112887381

View in Genome Browser
Species Human (GRCh38)
Location 13:104191420-104191442
Sequence GTGTGAAAAAAATCTCGCAC CGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1112887378_1112887381 26 Left 1112887378 13:104191371-104191393 CCAGAAATGTACAAATTAGTAAG No data
Right 1112887381 13:104191420-104191442 GTGTGAAAAAAATCTCGCACCGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1112887381 Original CRISPR GTGTGAAAAAAATCTCGCAC CGG Intergenic
No off target data available for this crispr