ID: 1112899237

View in Genome Browser
Species Human (GRCh38)
Location 13:104339148-104339170
Sequence AAATTAAAGAAAGCCTGGGG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1112899237_1112899241 -9 Left 1112899237 13:104339148-104339170 CCTCCCCAGGCTTTCTTTAATTT No data
Right 1112899241 13:104339162-104339184 CTTTAATTTTTTTTTTTTTTCGG No data
1112899237_1112899244 20 Left 1112899237 13:104339148-104339170 CCTCCCCAGGCTTTCTTTAATTT No data
Right 1112899244 13:104339191-104339213 CCATTCCTTCGTATTTCCACAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1112899237 Original CRISPR AAATTAAAGAAAGCCTGGGG AGG (reversed) Intergenic
No off target data available for this crispr