ID: 1112899238

View in Genome Browser
Species Human (GRCh38)
Location 13:104339151-104339173
Sequence AAAAAATTAAAGAAAGCCTG GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1112899238_1112899246 29 Left 1112899238 13:104339151-104339173 CCCCAGGCTTTCTTTAATTTTTT No data
Right 1112899246 13:104339203-104339225 ATTTCCACAGGCTCATTCCAAGG No data
1112899238_1112899244 17 Left 1112899238 13:104339151-104339173 CCCCAGGCTTTCTTTAATTTTTT No data
Right 1112899244 13:104339191-104339213 CCATTCCTTCGTATTTCCACAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1112899238 Original CRISPR AAAAAATTAAAGAAAGCCTG GGG (reversed) Intergenic