ID: 1112899240

View in Genome Browser
Species Human (GRCh38)
Location 13:104339153-104339175
Sequence AAAAAAAATTAAAGAAAGCC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1112899240_1112899244 15 Left 1112899240 13:104339153-104339175 CCAGGCTTTCTTTAATTTTTTTT No data
Right 1112899244 13:104339191-104339213 CCATTCCTTCGTATTTCCACAGG No data
1112899240_1112899246 27 Left 1112899240 13:104339153-104339175 CCAGGCTTTCTTTAATTTTTTTT No data
Right 1112899246 13:104339203-104339225 ATTTCCACAGGCTCATTCCAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1112899240 Original CRISPR AAAAAAAATTAAAGAAAGCC TGG (reversed) Intergenic
No off target data available for this crispr