ID: 1112899242

View in Genome Browser
Species Human (GRCh38)
Location 13:104339187-104339209
Sequence TGGAAATACGAAGGAATGGA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1112899242_1112899250 26 Left 1112899242 13:104339187-104339209 CCATCCATTCCTTCGTATTTCCA No data
Right 1112899250 13:104339236-104339258 AAATCCTACCAGGAGCCTCCAGG No data
1112899242_1112899246 -7 Left 1112899242 13:104339187-104339209 CCATCCATTCCTTCGTATTTCCA No data
Right 1112899246 13:104339203-104339225 ATTTCCACAGGCTCATTCCAAGG No data
1112899242_1112899249 16 Left 1112899242 13:104339187-104339209 CCATCCATTCCTTCGTATTTCCA No data
Right 1112899249 13:104339226-104339248 TACATTCTTGAAATCCTACCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1112899242 Original CRISPR TGGAAATACGAAGGAATGGA TGG (reversed) Intergenic
No off target data available for this crispr