ID: 1112899244

View in Genome Browser
Species Human (GRCh38)
Location 13:104339191-104339213
Sequence CCATTCCTTCGTATTTCCAC AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1112899237_1112899244 20 Left 1112899237 13:104339148-104339170 CCTCCCCAGGCTTTCTTTAATTT No data
Right 1112899244 13:104339191-104339213 CCATTCCTTCGTATTTCCACAGG No data
1112899239_1112899244 16 Left 1112899239 13:104339152-104339174 CCCAGGCTTTCTTTAATTTTTTT No data
Right 1112899244 13:104339191-104339213 CCATTCCTTCGTATTTCCACAGG No data
1112899240_1112899244 15 Left 1112899240 13:104339153-104339175 CCAGGCTTTCTTTAATTTTTTTT No data
Right 1112899244 13:104339191-104339213 CCATTCCTTCGTATTTCCACAGG No data
1112899238_1112899244 17 Left 1112899238 13:104339151-104339173 CCCCAGGCTTTCTTTAATTTTTT No data
Right 1112899244 13:104339191-104339213 CCATTCCTTCGTATTTCCACAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1112899244 Original CRISPR CCATTCCTTCGTATTTCCAC AGG Intergenic
No off target data available for this crispr