ID: 1112899246

View in Genome Browser
Species Human (GRCh38)
Location 13:104339203-104339225
Sequence ATTTCCACAGGCTCATTCCA AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1112899242_1112899246 -7 Left 1112899242 13:104339187-104339209 CCATCCATTCCTTCGTATTTCCA No data
Right 1112899246 13:104339203-104339225 ATTTCCACAGGCTCATTCCAAGG No data
1112899240_1112899246 27 Left 1112899240 13:104339153-104339175 CCAGGCTTTCTTTAATTTTTTTT No data
Right 1112899246 13:104339203-104339225 ATTTCCACAGGCTCATTCCAAGG No data
1112899239_1112899246 28 Left 1112899239 13:104339152-104339174 CCCAGGCTTTCTTTAATTTTTTT No data
Right 1112899246 13:104339203-104339225 ATTTCCACAGGCTCATTCCAAGG No data
1112899238_1112899246 29 Left 1112899238 13:104339151-104339173 CCCCAGGCTTTCTTTAATTTTTT No data
Right 1112899246 13:104339203-104339225 ATTTCCACAGGCTCATTCCAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1112899246 Original CRISPR ATTTCCACAGGCTCATTCCA AGG Intergenic
No off target data available for this crispr