ID: 1112899355

View in Genome Browser
Species Human (GRCh38)
Location 13:104340042-104340064
Sequence TTGTGTATACAGAGGCAAGC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1112899355_1112899359 3 Left 1112899355 13:104340042-104340064 CCTGCTTGCCTCTGTATACACAA No data
Right 1112899359 13:104340068-104340090 CCACCATCCTCCCTGTGCTTAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1112899355 Original CRISPR TTGTGTATACAGAGGCAAGC AGG (reversed) Intergenic
No off target data available for this crispr