ID: 1112904687

View in Genome Browser
Species Human (GRCh38)
Location 13:104402383-104402405
Sequence GTGACAACACAGATGAACCT GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1112904684_1112904687 4 Left 1112904684 13:104402356-104402378 CCTGAAAAAAAGAAAATCCTGTC No data
Right 1112904687 13:104402383-104402405 GTGACAACACAGATGAACCTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1112904687 Original CRISPR GTGACAACACAGATGAACCT GGG Intergenic
No off target data available for this crispr