ID: 1112919779

View in Genome Browser
Species Human (GRCh38)
Location 13:104597874-104597896
Sequence CTCAGAAAGAAGGAGGGCCA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1112919779_1112919784 -7 Left 1112919779 13:104597874-104597896 CCCTGGCCCTCCTTCTTTCTGAG No data
Right 1112919784 13:104597890-104597912 TTCTGAGAACTGAAAGAGTTTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1112919779 Original CRISPR CTCAGAAAGAAGGAGGGCCA GGG (reversed) Intergenic
No off target data available for this crispr