ID: 1112919784

View in Genome Browser
Species Human (GRCh38)
Location 13:104597890-104597912
Sequence TTCTGAGAACTGAAAGAGTT TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1112919778_1112919784 -6 Left 1112919778 13:104597873-104597895 CCCCTGGCCCTCCTTCTTTCTGA No data
Right 1112919784 13:104597890-104597912 TTCTGAGAACTGAAAGAGTTTGG No data
1112919777_1112919784 -2 Left 1112919777 13:104597869-104597891 CCTGCCCCTGGCCCTCCTTCTTT No data
Right 1112919784 13:104597890-104597912 TTCTGAGAACTGAAAGAGTTTGG No data
1112919780_1112919784 -8 Left 1112919780 13:104597875-104597897 CCTGGCCCTCCTTCTTTCTGAGA No data
Right 1112919784 13:104597890-104597912 TTCTGAGAACTGAAAGAGTTTGG No data
1112919779_1112919784 -7 Left 1112919779 13:104597874-104597896 CCCTGGCCCTCCTTCTTTCTGAG No data
Right 1112919784 13:104597890-104597912 TTCTGAGAACTGAAAGAGTTTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1112919784 Original CRISPR TTCTGAGAACTGAAAGAGTT TGG Intergenic
No off target data available for this crispr