ID: 1112920618

View in Genome Browser
Species Human (GRCh38)
Location 13:104607351-104607373
Sequence GGTATTGCCGAGGATATTGA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1112920618_1112920624 17 Left 1112920618 13:104607351-104607373 CCTTCAATATCCTCGGCAATACC No data
Right 1112920624 13:104607391-104607413 TTTCAGTATACTCAGCAGTGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1112920618 Original CRISPR GGTATTGCCGAGGATATTGA AGG (reversed) Intergenic
No off target data available for this crispr