ID: 1112931236

View in Genome Browser
Species Human (GRCh38)
Location 13:104740898-104740920
Sequence ATGCTGTGCTTGCTGGGACA GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1112931230_1112931236 -2 Left 1112931230 13:104740877-104740899 CCCTGGATGTCCTTCAAACAGAT No data
Right 1112931236 13:104740898-104740920 ATGCTGTGCTTGCTGGGACAGGG No data
1112931231_1112931236 -3 Left 1112931231 13:104740878-104740900 CCTGGATGTCCTTCAAACAGATG No data
Right 1112931236 13:104740898-104740920 ATGCTGTGCTTGCTGGGACAGGG No data
1112931228_1112931236 21 Left 1112931228 13:104740854-104740876 CCGTGGCACAATTGGCTGTTCGT No data
Right 1112931236 13:104740898-104740920 ATGCTGTGCTTGCTGGGACAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1112931236 Original CRISPR ATGCTGTGCTTGCTGGGACA GGG Intergenic
No off target data available for this crispr