ID: 1112935669

View in Genome Browser
Species Human (GRCh38)
Location 13:104795027-104795049
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1112935664_1112935669 1 Left 1112935664 13:104795003-104795025 CCTGAGGCACAGCGGCCTGCTCC No data
Right 1112935669 13:104795027-104795049 CTCCCGGATCTTGCTAAGGCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1112935669 Original CRISPR CTCCCGGATCTTGCTAAGGC AGG Intergenic
No off target data available for this crispr