ID: 1112936712

View in Genome Browser
Species Human (GRCh38)
Location 13:104809596-104809618
Sequence GCCTCTCCTTAGCCTCAGCC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1112936712_1112936716 30 Left 1112936712 13:104809596-104809618 CCAGGCTGAGGCTAAGGAGAGGC No data
Right 1112936716 13:104809649-104809671 TTGAAATCTCTAGCACTCTCAGG No data
1112936712_1112936713 1 Left 1112936712 13:104809596-104809618 CCAGGCTGAGGCTAAGGAGAGGC No data
Right 1112936713 13:104809620-104809642 AGCCAGCAGCCAGCAGATGAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1112936712 Original CRISPR GCCTCTCCTTAGCCTCAGCC TGG (reversed) Intergenic
No off target data available for this crispr