ID: 1112944708

View in Genome Browser
Species Human (GRCh38)
Location 13:104914084-104914106
Sequence CTTCATTTGGAGAATGCGGA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1112944708_1112944714 9 Left 1112944708 13:104914084-104914106 CCATCCGCATTCTCCAAATGAAG No data
Right 1112944714 13:104914116-104914138 ACTTGCACGAGGTCACACTAAGG No data
1112944708_1112944715 26 Left 1112944708 13:104914084-104914106 CCATCCGCATTCTCCAAATGAAG No data
Right 1112944715 13:104914133-104914155 CTAAGGTTTGAAGTCAGAATTGG No data
1112944708_1112944713 -2 Left 1112944708 13:104914084-104914106 CCATCCGCATTCTCCAAATGAAG No data
Right 1112944713 13:104914105-104914127 AGGGTTATGTGACTTGCACGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1112944708 Original CRISPR CTTCATTTGGAGAATGCGGA TGG (reversed) Intergenic
No off target data available for this crispr