ID: 1112946717

View in Genome Browser
Species Human (GRCh38)
Location 13:104937115-104937137
Sequence GAATATAAGCAGAAACTGGA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1112946717_1112946720 6 Left 1112946717 13:104937115-104937137 CCTTCCAGTTTCTGCTTATATTC No data
Right 1112946720 13:104937144-104937166 TATTTCTCCTAATTCTCCACAGG No data
1112946717_1112946721 7 Left 1112946717 13:104937115-104937137 CCTTCCAGTTTCTGCTTATATTC No data
Right 1112946721 13:104937145-104937167 ATTTCTCCTAATTCTCCACAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1112946717 Original CRISPR GAATATAAGCAGAAACTGGA AGG (reversed) Intergenic
No off target data available for this crispr