ID: 1112952965

View in Genome Browser
Species Human (GRCh38)
Location 13:105024238-105024260
Sequence ATGTGCTTTTCTAATTGTGA GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1112952962_1112952965 8 Left 1112952962 13:105024207-105024229 CCTTTGTTGTATTTATCCTTTCA No data
Right 1112952965 13:105024238-105024260 ATGTGCTTTTCTAATTGTGAGGG No data
1112952963_1112952965 -8 Left 1112952963 13:105024223-105024245 CCTTTCAATTTCAACATGTGCTT No data
Right 1112952965 13:105024238-105024260 ATGTGCTTTTCTAATTGTGAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1112952965 Original CRISPR ATGTGCTTTTCTAATTGTGA GGG Intergenic
No off target data available for this crispr